2020-11-07 234 ziņas

⚡Vigants Lesausks
(23:59:09) links

Nelaiž vaļā. https://t.co/iCrR6CojkV

Jānis Līmežs
(23:39:23) links

Nja, un, starp citu, Latvijā jau arī tam ir ilustratīvs precendents, ka uzņēmējs valsts galvgalī neiederas. https://t.co/TuASfyrfms

Uldis
(23:37:10) links

Action-adventure filmām ir ļoti garlaicīga romantīskā arka.

Māris Antons
(23:34:06) links

https://t.co/WtIT5LowjX

Reinis Traidās
(23:25:44) links

RT @VaushV: Oh my fucking god it’s real. The Trump team booked the wrong “four seasons” and now it all ends in a landscaping firm parking l…

⚡Vigants Lesausks
(23:21:44) links

Troļļu armija cītīgi cenšas kurināt kašķi ASV. Daudz līdzīgas ziņas no dažādiem kontinentiem. Un tādu ir simtiem.

Gunta Sloga
(23:17:41) links

RT @franakviacorka: Democracy vs Dictatorship https://t.co/ltQH4SB8pN

Mairis Skuja
(23:07:18) links

Šīs dienas galvenais notikums. https://t.co/JyNhw6ClWG

Pēteris Krišjānis
(23:05:54) links

Ak jā, Sherlock piektā sezona būs

1
Gunta Sloga
(22:49:45) links

RT @henrymance: Compare and contrast - the UK and German foreign ministers’ responses https://t.co/BYouk7oYJs

Pēteris Krišjānis
(22:45:28) links

Var just ka daudzu cilvēku spekulācijas par vēlēšanu iznākumu ka Tramps maģiski kaut kā var iztiesāt uzvaru nāk no nezināšanas un radītās auras, ka Tramps kaut kādā veidā uzvar tiesās. Viņš neuzvar. Praktiski nekad.

Igors Prokofjevs
(22:41:32) links

RT @HamillHimself: #BestEpisode_EVER https://t.co/n7oJx9BrhE

G. Arvissons
(22:38:51) links

Hahaaa! Kijevieši sveicina slāvus no Maskavas provinces. https://t.co/PzSj0C6AXo

Ernests Štāls
(22:33:12) links

RT @jillsobule: https://t.co/AezwZFJP9y

Pēteris Krišjānis
(22:28:53) links

RT @RestingPlatypus: DOGS BACK IN THE WHITE HOUSE. https://t.co/0RfCjTyHF6

Zile Davidsone
(22:27:03) links

RT @Valsts_policija: Policija šovakar ir saņēmusi informāciju, ka šorīt, 7. novembrī, plkst. 7.00 no adreses Rīgā, Piebalgas ielā, ir pazud…

Jurģis Ķiršakmens
(22:26:00) links

RT @SlexAxton: I feel like we didn’t focus enough on the fact that someone in the Trump campaign meant to schedule the “four seasons hotel”…

Pēteris Krišjānis
(22:24:27) links

RT @apollo_lv: Rīgā pazudusi četrus gadus veca meitene. VP lūdz palīdzību bērna meklēšanā https://t.co/TS0LIwhOz3

Nellija Ločmele
(22:23:53) links

RT @sarahsackman: Kamala’s predecessors... https://t.co/llVfXHm2S4

Laura
(22:18:13) links

THIS IS WHY IT MATTERS!!! https://t.co/v4HJ0pZkhs

Gints Kiršteins
(22:14:53) links

RT @nntaleb: AOC, must we then compile a blacklist with the names of the 70 million who voted against your preferences? Must we not also…

Nellija Ločmele
(22:01:46) links

RT @MichelleObama: Van, thank you for expressing the sorrow and relief that we all feel. My hope is that those who hoped for a different ou…

Valdis Melderis
(21:53:18) links

Kā runāt ar aizvainotu bērnu (atver attēlu, lai redzētu pilno ainu) https://t.co/TMH7lBCXSQ

Girts
(21:53:08) links

RT @simongerman600: Decriminalizing some drugs can help your citizens to be healthier, reduce crime and safe you quite a bit money. Decisio…

Laura
(21:48:46) links

Pieļauju, ka dažiem būs pastiprināta interese par @KamalaHarris. Tāpēc iesaku noklausīties Wondery/MSNBC podkāstu Kamala: Next In Line (hosted by @JoyAnnReid), tikai 6 epizodes.

Aigars Mahinovs
(21:47:47) links

RT @NBCNews: People celebrate on Black Lives Matter Plaza across from the White House in Washington, DC, as Joe Biden is projected to win t…

Vita Dreijere
(21:45:55) links

Kam varētu būt grūtāk saprast, ka ir pilnīgi ne tur, kur vajadzētu būt: a) Trampam Baltajā namā vai b) Rīgas Dinamo Kontinentālajā hokeja līgā?

Atecina
(21:44:16) links

Iknedēļas izdevums “Ko tviteris tev nestāsta”.

Atecina
(21:40:46) links

Es pēdējā laikā jūtos kaut kāda satrakojusies.

Austra Jāvalde Dārziņa
(21:25:58) links

Ja man būtu Cheetos, es arī uzkāptu. https://t.co/HCwaQpW8Zm

Atecina
(21:14:20) links

Vispār ir divas lietas, kas vienmēr liek justies bezgala skaistai - kailas peldes un īstā mūzika.

Māris Antons
(21:14:06) links

Nebūs viss perfekti, bet šodien ir iemesls svinēt. Priekā!

Māris Antons
(21:13:30) links

RT @jwiechers: German news magazine @derspiegel commenting on US politics. #Election2020 How it started How it's going (…

biedrs Dže ☠
(21:11:50) links

RT @anenews: Women just arrived at the Clark County election department. They tell me they’re praying justice will be done and that righteo…

Kārlis Langins
(21:11:27) links

RT @Schwarzenegger: Congratulations to President-elect @JoeBiden and Vice-President-elect @KamalaHarris. I say this after every election, a…

Ernests Štāls
(21:10:01) links

Un vēl tev no manis, liela, liela buča...... mīļā

Alberts Jodis
(21:09:10) links

RT @TeamTrump: Statement from President @realDonaldTrump https://t.co/vAXtVk4Ifn

Atecina
(21:06:29) links

Vietējais radio uztver kaut kādu pasakainu klasiskās mūzikas staciju, kas visu dienu raida ierakstus no operām, baletiem un koncertiem. Atbraucu no bāriņa blakus ciemā, sēžu mašīnā zem zvaigznēm un saviļņojumā klausos kaut ko, kas lielāks par mums visiem.

Pēteris Krišjānis
(21:06:08) links

RT @MichaelDTubbs: That little girl is VP. https://t.co/KayYcuZlmx

Pēteris Krišjānis
(21:03:39) links

Vēlēšanu meme popūrijs

N.R.
(21:00:33) links

Ļoti iesaku noklausīties. Brad Pitt ierunājis podcast par Nick Drake īso un traģisko dzīvi: https://t.co/IeFZXw4dU3

⚡Vigants Lesausks
(21:00:30) links

Neveiksme parāda kurš ir īsts draugs. Atbalsta, uzmundrina, iedrošina. Šobrīd, šķiet, Trampam pavisam maz palicis ļoti īsā laikā.


(20:59:57) links

RT @jonostrower: Today in international relations. https://t.co/HWVPUPm4iP

Mārtiņš Bruņenieks
(20:59:10) links

RT @deceuninck_qst: Tacatacatacatacatacatacatacata catacatacatacatacatacatacataca tacatacatacatacatacatacatacata catacatacatacatacatacatacatac

Ramūns Usovs
(20:54:11) links

RT @codinghorror: Hopescrolling

Jurģis Ķiršakmens
(20:50:13) links

RT @AkiyoshiKitaoka: Vertical or horizontal borders appear to tilt. https://t.co/Q9ul0dCZXd

Atecina
(20:41:57) links

Varbut garumzimes ir parvertetas?

1
andrejs teteris
(20:23:43) links

sagarlaikojās :) https://t.co/53nCXSBCIk

⚡Vigants Lesausks
(20:22:23) links

RT @BillGates: I look forward to working with the new administration and leaders on both sides in Congress on getting the surging pandemic…

Reinis Traidās
(20:10:14) links

Ciets tas grābeklis. https://t.co/pj365rd9k2

Pēteris Krišjānis
(20:07:39) links

Priekā tad

3
Pēteris Krišjānis
(20:06:48) links

RT @LapinsNiks: https://t.co/kH0CaL3cj5

Pēteris Krišjānis
(20:06:24) links

RT @MeganJTom: now, EVERYONE say THANK YOU to the 22 tribal nations of Arizona and across the nation! https://t.co/VjShRqhdid

Pēteris Krišjānis
(20:05:56) links

RT @ResisterForever: Breaking: Allegheny County military absentee ballots just went 4:1 for Biden. Moral of the story: don’t call your so…

Pēteris Krišjānis
(20:04:57) links

https://t.co/Nt5aoGA7io https://t.co/SuEbH446NN

Atecina
(20:04:09) links

“We live to fight another day.”

N.R.
(20:03:19) links

Tik labs

N.R.
(20:02:43) links

Pizģets https://t.co/qB9NyDOQAo

Zile Davidsone
(20:00:03) links

RT @TheTweetOfGod: You owe it all to Me. Me, and nonwhites.

Gints Kiršteins
(19:53:51) links

RT @_JakubJanda: With Trump losing, let me spell out the Trump administration policies which Europe needs the Biden team to keep. Change r…

Laura
(19:51:19) links

⚡Vigants Lesausks
(19:48:41) links

Pasaulē populārākā TV seriāla 4. sezonas noslēdzošā sērija beigusies... vēl gan titri, "bloperi" un "behind the scenes" sekos ar kautiņu pie kinoteātra tiem, kuriem beigas nepatika. Tagad laiks pievērsties dokumentālajai šausmu filmai "Covid-19".

1
Aigars Mahinovs
(19:48:37) links

RT @OfficialJLD: “Madam Vice President” is no longer a fictional character. @KamalaHarris https://t.co/rg1fErtHGX

Aigars Mahinovs
(19:48:16) links

RT @cmclymer: The Mayor of Paris wastes no time

Pēteris Krišjānis
(19:44:20) links

Reāls 'Return Of Jedi' beigu montāžas vaibs šobrīd.

Laura
(19:43:24) links

Jā, neesam amerikāņi. Jā, ASV prezidenta izvēle tiešā veidā mūs neietekmē. Bet gadā, kad viss cits bijis pakaļā, kad tik ļoti nācies vilties cilvēkos un cilvēcē... šis tomēr ir brīdis, kad gribas smaidīt, gribas daudzīt ar kājām un spiegt "YESSSSS!" Kaut kas tomēr mainās uz labu! https://t.co/DUbBhc

Austra Jāvalde Dārziņa
(19:43:12) links

Pēteris Krišjānis
(19:40:40) links

Šogad daudzi jaunie progresīvie amerikāņi atklāti teica - Bidens nav mūsējais, bet mums kaut kur ir jāsāk. Jauniešiem veidojas sapratne par ilgtermiņa kontraktu veidošanu ar politiķiem.

3
Liene Liepiņa
(19:39:03) links

Why can’t Trump go to the White House anymore? Because it is for Biden!

Pēteris Krišjānis
(19:38:58) links

RT @BernieSanders: I want to congratulate all those who worked so hard to make this historic day possible. Now, through our continued grass…

Pēteris Krišjānis
(19:36:39) links

RT @EdwardNorton: Thank you @VanJones68 I mean, I didn’t plan to be weeping along with you in front of my kids in the kitchen but you’re ri…

andrejs teteris
(19:36:18) links

RT @TechnicallyRon: Somewhere in Washington DC right now Melania and her clones are escaping through the sewers to start their new lives in…

Pēteris Krišjānis
(19:36:07) links

RT @DaveWeasel: I encourage everyone to join the #TrumpBlockParty https://t.co/H5hMKWpUrZ

Kristaps Skutelis
(19:34:39) links

RT @kursorslv: Internetā, iespējams, noplūdis foto ar nākamo Apple AirPods modeli https://t.co/WmipZ5EmDW https://t.co/xPmeA1DxU6

Kristaps Skutelis
(19:34:36) links

RT @kursorslv: “Škoda” patentē jaunu risinājumu, kas atvieglos piesprādzēšanos tumsā https://t.co/L2XhMrPhtP https://t.co/fWfLiVJoQb

Uldis Ziediņš
(19:33:58) links

RT @StephenKing: One of the best days of my life.

Valdības māja
(19:30:00) links

Šobrīd jau 25 dažādas valsts un pašvaldības iestādes ieguvušas jaunas, pēc vienotiem principiem veidotas, mūsdienīgas un ērti lietojamas mājaslapas.

Atecina
(19:24:21) links

Es nezinu... šis ir labs gads.

Pēteris Krišjānis
(19:24:13) links

RT @charliestree: Ļoti žēl, ka mūsu galā, tepat kaimiņos, nav demokrātisku vēlēšanu, kas arī ļautu atviegloti apraudāties par daudziem cilv…

Zile Davidsone
(19:20:26) links

Ne mūsu prezidents, bet tomēr svētku un atvieglojuma sajūta.

Zile Davidsone
(19:16:39) links

4 gadu murgs ir beidzies. Vēl tikai tie 2 mēneši. Kas notiks to laikā? Bail.


(19:16:18) links

F

Aigars Mahinovs
(19:13:43) links

RT @TIME: BREAKING: Joe Biden has been elected the next President of the United States. Here's how he won the White House https://t.co/70t…

Mareks Matisons™
(19:11:51) links

RT @JohnSimpsonNews: Governments across Europe are breathing a huge sigh of relief after the end of Trump’s roller-coaster years. Putin w…

Vita Bērziņa
(19:10:05) links

Vismaz kaut kas labs noticis 2020.

Ģirts
(19:07:37) links

Mums nesaprast, cik daudzi viena idiota dēļ ir cietuši. #ByeByeDonny https://t.co/oFzkZ1Tj14

Pēteris Krišjānis
(19:05:39) links

Es domāju Hilarijai arī neliels kluss gandarījums par to.

Zile Davidsone
(19:05:27) links

Pēteris Krišjānis
(19:04:06) links

Pasūtiju visīti no deliveroo. Būsim nosvinēt. Lai vai kā ir tomēr pārmaiņas.

Zile Davidsone
(19:04:05) links

Pievienojos.

Eriks Stendzenieks
(19:03:32) links

Par spīti visam: Tev, kā zemi apmaksātam un anonīmam trollim ar 15 sekotājiem, tomēr atbildēšu. Tīri – aiz līdzjūtības. 1) "Imigrants" ir Kariņa un domubiedru svētvārds. 2) Imigranti ir jāuzņem, jāmīl, jāpieņem 3) Kur tTu saskati naidu? Tā ir slavas dziesma. 4) Citādi – cieņa. https://t.co/eKDwME

Aleksejs Mjaliks
(19:00:30) links

Galvenais, ka Nevada turpina vēl skaitīt.

Sergejs Bižāns
(18:58:47) links

Nu re, nebija ilgi jāgaida, lai matus skaldīt sāktu arī bez uzmanības atstātā @darbainspekcija Ja man, kā darba devējam, būs aizdomas, ka tiešā saskarē ar klientiem esoša persona var būt apdraudējums, man sākumā jāpakonsultējas. Lai apdraud. https://t.co/gkuoOcw3Dh


(18:55:57) links

RT @strobist: MADAM Vice President

Eriks Stendzenieks
(18:54:11) links

Aizpogā. Es došos pirtī un pie miera. https://t.co/24SvFsfPro

Kirils Solovjovs
(18:52:26) links

Here to gloat. #bidenharis2020 https://t.co/D9zhCP5LAX

Ģirts
(18:52:19) links

The darkest timeline has ended. Fuck you @realDonaldTrump. I really hope to see you and your dumpster fire of a family in chains and in prisonn in a year.

Kristaps Skutelis
(18:51:11) links

Nu, ko, ASV beidzot notika kaut kas labs? Varam apsveikt?

1
Aigars Mahinovs
(18:50:34) links

RT @FoxNews: Fox News projects Biden to defeat Trump, become 46th president after winning Nevada, Pennsylvania https://t.co/BTx2gwdT2N http…

Aigars Mahinovs
(18:50:25) links

RT @washingtonpost: Kamala Devi Harris, a daughter of Indian and Jamaican immigrants, is set to become the highest-ranking woman in the nat…

Uldis Ziediņš
(18:50:06) links

Paskat. Nostrādāja. #DumpTrump https://t.co/BwIBHbACtF

1
Ģirts
(18:49:17) links

RT @shinobi602: https://t.co/SijG8EcAXM

Laura
(18:48:50) links

Tieši laikā uz Trampa preseni haha https://t.co/DyB4XTIT1A

Kristaps Karlsons
(18:48:12) links

Uldis Ziediņš
(18:41:16) links

Tagad sāksies īstais šitstorms Trampa nometnē. Un ko viņš sastrādās atlikušajos 2 mēnešos, kamēr vēl būs pie varas... Uff, šis būs jautri.

7
Mareks Matisons™
(18:40:09) links

skumja diena babām un citiem apbrīnotājiem apsveicu pārējos! https://t.co/vLWWqBIXeF

Gints Kiršteins
(18:39:06) links

RT @Reuters: Democrat Joe Biden wins #Election2020 https://t.co/Gz2aiidIkf https://t.co/DpUd8r3w4Y

Ģirts
(18:38:53) links

Man no visas sirds šausmīgi riebjas mūzikli. Visa veida. Bet #hamiltonmusical ir ģeniāls. Izcils aranžējuma/iestudējuma/mūzikas meistardarbs.

Sergejs Bižāns
(18:35:41) links

Vismaz kaut kas labs 2020. būs noticis. https://t.co/NVbPTBbwVX

1
Ramūns Usovs
(18:35:40) links

Cheers 'murica https://t.co/jExWgjNUcY

Pēteris Krišjānis
(18:34:25) links

@Snowtales @MTarlaps Manuprāt lēmums bija ļoti pareizs darīt to lēnām. Atņēma ieročus Trampam satracināt savus atbalstītājus, darot to pamatīgi un pārbaudot visu.

Kaspars Foigts
(18:34:21) links

Baidens noteikti nav no labākajiem kandidātiem, bet Tramps bija četrus gadus ilga kļūda.

1
Mareks Matisons™
(18:31:32) links

RT @nprpolitics: #BREAKING: Joe Biden has been elected President of the United States, according to an AP race call. https://t.co/Ktba34KmM…

Mareks Matisons™
(18:31:08) links

RT @NBCNews: BREAKING: JOE BIDEN WILL BE PRESIDENT-ELECT, NBC NEWS PROJECTS. https://t.co/Xa3wMXmHT6

Kaspars Foigts
(18:30:22) links

RT @dzhein_: Mums ļoti vajag šādus reklāmas stabus!!

Pēteris Krišjānis
(18:28:14) links

RT @the_moviebob: CNN Projects the win. It's done. #PresidentElectBiden

Pēteris Krišjānis
(18:28:05) links

CNN apnika - šķiet PA balsis ir sasniegušas no point of return.

Atecina
(18:23:30) links

Vienmēr biju domājusi, kā tas būtu - iepazīties ar pievilcīgu vīrieti pliko ciemā. Šodien piepildījās. Iespējamību adrenalīns izblieza smadzenes.

Pēteris Krišjānis
(18:22:13) links

RT @thehill: #BREAKING: Multiple White House staffers test positive for coronavirus https://t.co/bKdjgr0XEs https://t.co/GHHXjwH1S2

andrejs teteris
(18:12:20) links

"No tavas mutes Dieva ausī. Es to kā teologs saku." @za_ne 07.11.2020

Eriks Stendzenieks
(18:10:56) links

RT @Tonuspomus: Tonight T. Rex will be inducted in the RnRHoF. I am so happy for Marc Bolan. He would've been over the moon if he got thi…

Edgars Jēkabsons
(18:03:28) links

@miers_majas @KustibaPar @zarinstoms @AttistibaiPar @progresivie Šo problēmu un arī iespējamos piedāvājumus apspriežam iekšēji. Vakar @anna_brake novadīja interesentiem ātro kursu par nodokļiem un topošajām problēmām Reira reformas dēļ. Piekrītu, ka mums nepieciešams nākt ar skaidriem priekšlikumiem

5
Pēteris Krišjānis
(17:50:03) links

RT @katiehobbs: My office has been putting out information for months about how election processes work in the state & all we do to ensure…

biedrs Dže ☠
(17:49:17) links

https://t.co/p88dO3RhzW

3
Mareks Matisons™
(17:40:43) links

@edgarsj @didzvein Sedlenieka kunga iekšējais kompass viņu ārpolitikā pieviļ jau gadiem. Taču, laikam jau nav citu variantu, kā publicēt viņa alternatīvo viedokli (:

Pēteris Krišjānis
(17:36:09) links

PA +29k, AZ un NV gaidam ziņas. GA +4k, tā izskatās arī paliks, būs pārskaitīšana, bet visticamāk neko fundamentāli tas mainīt nevarēs. AP gaida AZ un PA pabeigšanu lai beidzot paziņotu Baidenu. Varētu būt šodien/rīt.

2
Zile Davidsone
(17:33:46) links

Kur var izlasīt aktuàlos ierobežojumus pakalpojumu sniedzējiem? Atrodu tikai veikalniekiem.

Edgars Jēkabsons
(17:27:53) links

Vēl par ASV vēlēšanu "nozagšanu" runājot: 1. parasti vēlēšanas nozagt stipri reālāk ir pie varas esošajam, nevis jaunam kandidātam 2. ASV partijām standarta taktika - republikāņi cīnās, lai samazinātu vēlētāju aktivitāti (nobalsot būtu grūtāk), demokrāti - lai palielinātu. https://t.co/7p9cp6EPVP

1
Eriks Stendzenieks
(17:25:33) links

Mani un manu tuvinieku nervi ir saspringti līdz pēdējam. Tūces savilkušās un kuru katru brīdi graus vaļā vētra. Tie ar vājākiem nerviem tver pēc Karvolola.... Suns gaudo, kaķis slēpjas. Tūdaļ. ... ... ... ... Fuh. Uzliku peļu slazdu, neicērtot pirkstus.

Zile Davidsone
(17:20:38) links

Man liekas, ka arguments par katras dzīvības nozīmi nav aktuāls lielai daļai sabiedrības, kam interesē tikai privāts ieguvums vai zaudējums. Domāju, ka jākomunicē zaudējumi. Piemēram pārslogotās veselības sistēmas ārstu nepietiekamība. Man tuvākā tēm ir dzemdību nodaļas. https://t.co/lN4mI4XCB9

1
biedrs Dže ☠
(17:19:05) links

RT @didzvein: Alternatīvās realitātes jaunākā teorija ir, ka Ķīna Baidenam viltojusi vēlēšanu rezultātus. Tas, ka Krievija būtu savu troļļu…

Nora
(17:17:10) links

https://t.co/Xer8PyNcWg

Nora
(17:12:57) links

RT @depressionnote: I Know It’s Hard But Things Will Get Better Keep going

biedrs Dže ☠
(17:10:40) links

RT @AtisLejins: IESAKU!

Raimons Cajet
(17:09:04) links

ASV prezidenta vēlēšanu rezultātu apkopošanas seriāls sāk kairināt. Pirmajās dienās bija drāma, negaidīti pavērsieni. Pēdējo diennaktī tikai "Previously on Election night..." Standarta seriālu problēma - stiepj garumā, līdz reitingi nokrīt līdz nullei.

1
Atecina
(17:08:31) links

Melna lava, balts dvielis, zils okeāns.

mr. architect
(17:01:04) links

šajā pandēmijas laikā ir ļoti svarīgi neko nevēlēties, jo ja tu kaut ko ļoti vēlies, visa pasaule sadosies rokās

Kristaps Mors
(16:59:20) links

RT @Savings_Freedom: iban Wallet: A Warning Message I decided to stop promoting iban wallet on my blog. Too many questions and smoke arou…

Eriks Stendzenieks
(16:58:30) links

Pagaidi. Bet ko darīt, ja valdība pasūta ratā teju jebkuru atbalsta ubagotāju? Ok, ja maksā kompensācijas, turklāt – ne simboliskas un ne tikai tiem 10%, kuri atbilst kaut kādiem mistiskiem kritērijiem, bet – kā Rietumeiropā? Es darītu tieši tāpat. Veriet ciet, bet maksājiet. https://t.co/qlAHXSxrOW

3
Zigurds Zakis
(16:34:14) links

Festivāla #ClioSports 2020 bronzu ieguvusi mobil-interaktīva vides reklāma kampaņa #KRISSTOPS ar @kporzee galvenajā lomā: https://t.co/62OIESCG4h Cita perspektīva: https://t.co/Vkwlb3ad4W #Advertising #Awards via @ClioAwards by @dallasmavs

biedrs Dže ☠
(16:31:44) links

Patīkami. https://t.co/FmTagukLo2

Sergejs Bižāns
(16:22:35) links

Leiši ne tikai adaptējuši veiksmīgu internetjoku, bet arī uztaisījuši Pasažieru vilcienam rebrendingu. https://t.co/krK20xYuhx

cosmix
(16:15:11) links

RT @meInsuzbaIta: Lietuvā jau gandrīz 2000 dienā, bet mums nav vēl ārkārtas stāvokļa, bet, kad būs, arī tad leiši turpinās braukt uz Jelgav…

Sergejs Bižāns
(16:02:50) links

Izcils foto, @lsmlv Kas ir autors? https://t.co/T9MBczI7eB

Girts
(15:35:20) links

RT @MaxCRoser: Per capita CO2 emissions over the long run – by world region. [From our new CO2 Data Explorer: https://t.co/wuWvDlLcNS] htt…

Sergejs Bižāns
(15:25:28) links

@laacz @slaabsti Proktologu uz haltūru izsaukt, ko gan citu.

Ģirts Liepiņš
(15:15:25) links

Hey, @apturicovid !? https://t.co/X3hWpADGrr

N.R.
(15:12:02) links

RT @dodieslv: Īstais brīdis aizbēgt! Takas: https://t.co/ZjSIWA7P0k Vēsture: https://t.co/M9c9PuQeJs Pilsētas: https://t.co/5MCxtkgF6Z Mē…

Kristaps Skutelis
(15:05:35) links

Tiku veiksmīgi galā līdz Rēzeknei ar moci. Nav ne vainas braukt arī šādā laikā. Jāsaģērbjas tikai silti. Nu, un sapratu, ka apsildāmās ručkas varētu būt baigā štelle.

Atecina
(15:03:53) links

Šodien ārā visi grādi.

Reinis Traidās
(15:02:18) links

Hei @Citadele lūdzu uztaisiet beidzot krājkasītes iespēju ikdienas naudas atlikšanas vajadzībām. Jūsu “krājkonts ar 30 dienu izņemšanas laiku” galīgi nav ērts :)

3
Agris Krusts
(14:59:12) links

Latvijā, starp kreisajiem populāra ASV demokrātu politiķe izteikusi interesantu ideju. Faktiski iznākusi no skapja. Gan jau, ka tas tikai sākums https://t.co/qaWj89zb22

5
Agris Krusts
(14:54:45) links

RT @nntaleb: AOC, must we then compile a blacklist with the names of the 70 million who voted against your preferences? Must we not also…

N.R.
(14:53:28) links

RT @SandisSauka: Varbūt kādai kafejnīcai vai restorānam noder gatavs risinājums: produktu/ēdienu katalogs, to pasūtīšana, apmaksa (tiktāl l…

Pēteris Krišjānis
(14:51:56) links

RT @LigaVasara: @oliniete @leldluce @Bumbuls2 @veselibasmin Vai nepastāv versija tomēr skolās atstāt tikai tos, kas tiešām citādi nevar? Un…


(14:40:01) links

RIP Leons Krivāns

Eriks Stendzenieks
(14:38:34) links

Tiktāl par meliem: Kariņš: "Balsojums par Ārkārtas Situāciju bija vienbalsīgs". Tiešām, imigrant? Izrādās – vismaz 2 ministri bija pret. --- Udate: 3 ministri. Tālāk jau lai žurnālisti skaidro. Negribu būt tas, kurš kādu pamet zem tankiem. No atbildēm jau būs skaidrs.

3
Matīss Murgonis
(14:36:55) links

Ja Tev pietrūkst WINDOWS XP, vēlies pagremdēties atmiņās. Lūdzu https://t.co/99OOvAB3OU

Māris Antons
(14:32:13) links

RT @DerTwitler: Ņemot vērā bāru/kafejnīcu "nāciet visi, kamēr vēl var - mums ir atlaides", gribās pateikt 3 lietas: 1) Covid negaidīs pirm…

⚡Vigants Lesausks
(14:31:43) links

Velns. Tas galīgi nav labi. Cilvēki, lūdzu, LŪDZU lietosim maskas. Šodien veikalā pērkot pārtiku redzēju vairums cilvēku ar maskām, bet diemžēl bija arī daži bez. Atgādināsim šiem cilvēkiem ka maskām jābūt! https://t.co/dDGghJ8VUk

Pēteris Krišjānis
(14:18:14) links

Polija 27k. Nu kas notiek :(

Pēteris Krišjānis
(14:10:43) links

Un kaķis arī pateiks, "kā ir". https://t.co/DgxUykR6fz

Pēteris Krišjānis
(14:03:38) links

Gunta Sloga
(13:59:11) links

Izskatās, ka šogad nebūs arī Ziemassvētku tirdziņu. Pēdējos gados tādus rīkoja cilvēki ar īpašām vajadzībām, pensionāri. Varbūt, ka kāds no tirgotājiem, kam jau ir spēcīga e-tirgošanas platorma, varētu rīkot tiešsaistes tirdziņus? @RimiLatvija @barbora_lv

Signe Dean
(13:57:50) links

RT @anneapplebaum: Remember: if Pennsylvania had begun counting early votes early, like so many other states did, this would be over. But P…

Māris Antons
(13:51:35) links

Pēdējās 24h pozitīvo covid testu skaits – page not found.

Pēteris Krišjānis
(13:48:01) links

Tusējam, neatlaižam, lai var vīruss līdz pat februārim darboties! https://t.co/Jag1oMuJIB

Pēteris Krišjānis
(13:47:15) links

Ļoti daudzi man zināmi vecāki vīrieši 'pēkšņi' mirst Latvijā šoruden. Es jau neko.

Pēteris Krišjānis
(13:44:49) links

RT @suvajevs: Vai kāds var paskaidrot, kāpēc ārkārtējās situācijas laikā fitnesa un trenažieru zāles paliek pieejamas apmeklētājiem? Vai tā…

Eriks Stendzenieks
(13:41:11) links

Ahahaaaahaaaaa https://t.co/SdtxSEhsZJ

Eriks Stendzenieks
(13:32:16) links

RT @AnitaDaukste: Kariņa valdība kā Skārleta O’Hāra: šodien pieņemam ierobežojumus. Atbalsts? Par to es padomāšu rīt!

Pēteris Krišjānis
(13:28:00) links

Dienas apjausma kā fašisti un nacisti nonāk pie varas - caur trivializāciju. Teksasā latino balsojuši par Trampu tāpēc, jo esot bijušas šaubas ka kaut kas notiks naftas laukiem, ja Baidens būs prezidents, un tur daudzi viņu ģimenes locekļi strādā.

2
Aleksejs Mjaliks
(13:20:53) links

Kur tas pazuda

N.R.
(13:18:14) links

1
Eriks Stendzenieks
(13:12:53) links

Tiktāl par meliem: Kariņš: "Balsojums par Ārkārtas Situāciju bija vienbalsīgs". Tiešām, imigrant? Izrādās – vismaz 2 ministribija pret. Ārkārtas sēžu balsojumu listes nav publiski pieejamas, bet mēģināšu sadabūt. Tīri tā – melim par prieku.

4
Gints Kiršteins
(12:57:54) links

RT @SuperLuigi_Of:

Gints Kiršteins
(12:55:14) links

RT @JurisKrikis: Tikai Rīga. Redzam, ka 14-dienu vidējais, ko lieto, lai "nogludinātu", par apmēram trešdaļu atpaliek no reālās situācijas…

Pēteris Krišjānis
(12:34:38) links

RT @ReadMoreScience: LOOK AT ALL THE TINY BEANS ON THIS PAW https://t.co/vOJEpC0s52

Pēteris Krišjānis
(12:24:49) links

Into The Spider-Verse ir optimisma deva, ko man ļoti šobrīd vajag.

Pēteris Krišjānis
(12:22:46) links

RT @ltvzinas: Šodien savu 50. dzimšanas dienu svin @jrt_lv aktieris Vilis Daudziņš. Sveicam aktieri svētkos! https://t.co/kpZvOSz39J

Pēteris Krišjānis
(12:21:23) links

RT @PavilsJurjans: Esmu samulsis. Vispasaules diktāta video netiek straumēts kādā makten elastīgā infratruktūrā, piemēram, Youtube. Kādam i…

Kristaps Skutelis
(12:06:51) links

Ā, un nevajadzēja nofrizēties. Tagad vējš ķiverē klejo pa puspliku pakausi :D

Kristaps Skutelis
(12:04:54) links

Super! Paldies, mēs to paveicām! Tagad kādu ❤️ iedodam arī otram foršajam Latvijas tech jūtūberim - Konsumer https://t.co/HOdfXEtDP5 https://t.co/QTtpInv38x

Kristaps Skutelis
(11:55:32) links

Jožiks tumānā! https://t.co/p7RyXQsLZx

Kristaps Skutelis
(11:48:09) links

RT @kursorslv: MIT zinātnieki rada bez baterijām darbināmas zemūdens GPS ierīces https://t.co/n9mXY0TAqs https://t.co/wMjJ2KlpP6

Kristaps Skutelis
(11:46:14) links

Opiņā, palicis pavisam nedaudz līdz 2000 abonentiem @kursorslv YouTube kanālam! Vai tu jau seko? https://t.co/FpFS3eNkIZ

2
Kristaps Skutelis
(11:33:54) links

Cilvēki mīļie, kārtojiet A kategoriju un pērciet motociklus! Pat miglainā 10 grādu novembra rītā ar moci braukt ir kaifs nereālākais!

2
Sergejs Bižāns
(11:33:45) links

@and_kse @cybercannibal @Palkavnieks Tam ir nepieciešama speciāla licence, kuru VID izsniedz mēneša laikā, kas paredz to, ka tirgot var vai nu uz vietas, vai līdzņemšanai un tur vēl kaudze speciālo noteikumu.

2
Kristaps Skutelis
(11:32:52) links

Tējas laiks! https://t.co/ebWnOY17kh

1
Pēteris Krišjānis
(11:28:10) links

RT @Rkrahenbuhl: .@MarkMeadows tested positive for Covid-19. On election night he was at the White House party with the president and his f…

Kaspars Foigts
(11:26:05) links

Ja nu kas, šodien 12:15 VI pasaules diktāts latviešu valodā. https://t.co/5L1k0jXTGM

Zigurds Zakis
(11:16:52) links

Edgars (@epetersons) labi uzrakstījis par cilvēkiem, "kuriem šķiet, ka viņi ir gudrāki, apčakarēs sistēmu un, lai jau citiem iet sliktāk, galvenais ka man ies labi", kā arī par maziskumu, mazisko egoismu un meliem, kas baro vīrusu. Un ne tikai vīrusu(s). https://t.co/nIQdfQbQdu https://t.co/ip1ITXjo

Zigurds Zakis
(11:12:42) links

@atihomirovs @SandraMetra @lolifish @Kristap_s classico

Mairis Skuja
(11:03:57) links

@normundsbergs @akberzins @krizdabz @eriksmelbardis @EuJanka Padalīsies ar detaļām? Šis varētu būt labs acu atvērējs virknei kompāniju, kas skatās “austrumu virzienā”.

2
Mairis Skuja
(10:47:53) links

Šis ir gīkiem (brīdinājums), bet labs video par šī brīža iespējām piedabūt strādājošu GPU uz Pi4. https://t.co/5IQLM39tGv Mēs vienā projektā veikli atmetām šo domu, pārejot uz citu arhitektūru (paldies @ParaTr00per par idejām)... un labi vien ka tā. Būtu ilgi nomocījušies.

Edgars Jēkabsons
(10:29:18) links

RT @UN_Women: Without a seat at the decision-making table, women's specific needs are at risk of being overlooked. This brief shines a lig…

⚡Vigants Lesausks
(10:22:26) links

FB reklāma - Nezinu kā citiem bet 145k€ par dzīvokli kurā pārtiek no

3

(10:16:28) links

• • • • • #fujixt2 https://t.co/wQ8VcWs8bH https://t.co/ichcXZRgox

mr. architect
(10:12:51) links

klasika... https://t.co/YCkH62H92z

Kristaps Skutelis
(09:53:24) links

@normundsbergs @akberzins Viss ir risks. Mani interesē konkrētas lietas.

1
Kristaps Skutelis
(09:42:00) links

Brr, diezgan vēsi. Būs laikam jāuzģērbj lietus kārta. Ij vēju cauri nelaidīs, ij redzamāks būšu. https://t.co/5jQJlYzKGz

Mairis Skuja
(09:41:58) links

Labs lasāmgabals — “Есть несколько вещей, которые понятны из хода большой тысячелетней истории. Как только правитель собрался править пожизненно, обязательно что-нибудь произойдет.” https://t.co/qJRvY3fPke

Girts
(09:35:59) links

@normundsbergs @VrdsUzvrds1 Man tiešām grūti iedomāties, ko tur tādu var sataisīt par šādām izmaksām. Publiskā sektora IT lietas reizēm ir ļoti nesaprotamas.

Laura
(09:25:39) links

Something I realised at quite a young age, while some haven’t grasped it at the ripe old age of 74... https://t.co/mrCH5Tzlgl

Laura
(09:15:42) links

Šis bija nu ļoti paredzami! https://t.co/OlESDl6OcN

N.R.
(09:06:59) links

Šis vegānu Čedars ir garšīgāks par dažiem Latvijā ražotajiem piena Čedariem https://t.co/OdveeJ6OwS

8
Māris Reliņš
(08:40:27) links

Vienīgais krievu youtuberis, ko skatos, uztaisijis feinu epizodi par Šveici. Stundas garumā var atcerēties, kāpēc mums visiem patīk ceļot un izzināt citas valstis https://t.co/4ljuTvjrUu

7
Agris Krusts
(08:23:40) links

RT @atheist_from_lv: FB https://t.co/mBRQejAROy

Signe Dean
(08:21:02) links

RT @TaikaWaititi: Cant wait.

N.R.
(08:20:21) links

RT @AliVelshi: BREAKING: NBC News confirms at least 122,365 new COVID cases have been reported in the U.S. today, eclipsing yesterday's pre…

Agris Krusts
(08:18:25) links

ASV gadās arī šādi. Tas gan nav par šīm vēlēšanām. Un, cita starpā parāda, cik droša un uzticama ir tradicionālā vēlēšanu sistēma https://t.co/K3nH6QcdCp

Māris Antons
(07:15:56) links

RT @nytimes: Twitter flagged half of President Trump’s 14 posts on Thursday for including disputed or misleading information, as the compan…

Ernests Štāls
(07:00:50) links

RT @TheOnion: The Onion takes a closer look at the nation’s 50 worst states. https://t.co/gQJKZiX388

Signe Dean
(05:54:22) links

Crying into my curry watching Biden speak, not just about "winning" or "losing" or ego, but about what matters for his country.

biedrs Dže ☠
(04:42:43) links

RT @DavidCayJ: The Trump campaign moves from courting donors to getting aggressive with them, a clear sign of desperation. https://t.co/P1l…

biedrs Dže ☠
(04:41:55) links

RT @Oiks__: @ArvisKolmanis Tā nu tas ir, deputāts mēnešiem var izplatīt dezinformāciju, kas apdraud sabiedrību, bet neviens neko nevar pada…

Pēteris Krišjānis
(04:37:14) links

ASV reģistrēti ap 130k pozitīvi testi dienā.

Signe Dean
(03:51:01) links

RT @meenaharris: “You could be president.” https://t.co/akB2Zia2W7

Signe Dean
(03:50:11) links

RT @SaraKonrath: Our research has found that red & blue US political maps create increased perceptions of polarization and more political s…

Signe Dean
(01:35:48) links

RT @JamColley: STEVE BANNON: Now I’ll list the races from most to least important. JOURNALIST: Awful. Go on.

Uldis
(00:58:32) links

@mairisskuja @Amtmanis @Brivibas36 Vai ne? Vai kādam šis ir pārsteigums kā Rīdziniekiem pirmais sniegs decembrī?

Pēteris Krišjānis
(00:57:22) links

Twitteris varbūt grib Among Us kaut kad uzspēlēt tuvākajā laikā? Es varētu straumēt. Dod ziņu o/

1
Pēteris Krišjānis
(00:51:43) links

RT @RoadsForPaula: Hi just as a reminder, 0, literally ZERO progressives lost House Seats. It was all moderates. Why? Because centrism i…

Mareks Matisons™
(00:51:01) links

RT @adage: Voters in New Jersey, South Dakota, Montana and Arizona approved recreational pot legalization. That means new consumer markets…

Pēteris Krišjānis
(00:49:19) links

RT @rags_to_richard: STOP THE COUNT! https://t.co/FEXtdwEGoV

Uldis Ziediņš
(00:40:46) links

Šī bija notievēšanai nepiemērota nedēļa.

1
Pēteris Krišjānis
(00:36:10) links

RT @Redistrict: New: Biden's GA lead jumps to 4,262 w/ newly counted Gwinnett Co. ballots.

Pēteris Krišjānis
(00:21:36) links

PA turpina skaitīt, lai gan brīžiem iebirst vairāk Trampa balsis, beigās prognozē 25k - 50k plus Baidenam. NV nav zināms vai atjaunos datus rīt, bet pagaidām tur arī šaubu maz. Kanāli ļoti piesardzīgi izturās pret PA/NV calling. Gaida vēl lielāku skaidrību, Trampa dēļ protams.

1
Reinis Traidās
(00:15:44) links

Ar dziļu nopūtu meklēju, kur aizņemties labu matu griezšanas mašīnīti. Iepriekšējo reizi ar bārdas trimeri īsti viegli neizdevās.

1
Kaspars Foigts
(00:10:45) links

Neliels robots, kurš spēj pa iekārtiem reģipša griestiem pāri visiem profiliem autonomi aizlīst no viena cauruma līdz otram (kurā moš ielikts raidītājs), izvelkot līdzi šņori.

8
Laima
(00:08:10) links

@Sarmite_Kolate @anjo_lv Precīzi!

Pēteris Krišjānis
(00:03:56) links

Trampam naudiņas neesot lai tiesātos.

cosmix
(00:03:32) links

RT @sanitare: Aizkaitinātu uzkliegšanu sirmgalvjiem veikalos novēroju gandrīz katru reizi - ne tikai pret savu tanti vien. "Tāda sajūta, it…

cosmix
(00:03:30) links

RT @sanitare: Diezgan regulāri vedu tanti uz veikalu. Viņai patīk iepirkties pašai, visu darīt pašai. Viņai pāri 80. Stāvu nomaļus, vēroju.…